An answer for the other 80% of autism may have been found

Post Reply New Topic

The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders

Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail. In only one in five cases is a significant genetic mutation detected. However, an international team of scientists, proposed a possible explanation for the remaining 80% of cases on Wednesday: the loss of a tiny segment of a protein essential for brain development. The genetic code for this fragment consists of just 24 chemical letters: GCAAGGACATATGGGCGAAGGAGA. The researchers — led by biochemist Raúl Méndez, 59, and biophysicist Xavier Salvatella, 52 —believe that these 24 letters could be key to reversing autism.

To understand this breakthrough, we must go back to the very beginning: the fertilized egg. This single cell contains a kind of instruction manual, DNA, made up of around 3 billion letters. Each letter represents the initial of a chemical compound — G, for example, stands for guanine (C₅H₅N₅O). This solitary cell will divide and multiply, eventually forming a person composed of about 30 trillion cells, each distinct despite sharing the same DNA — whether it’s a neuron in the brain, a myocyte in the muscles, or a melanocyte in the skin.


The key to this diversity lies in the fact that DNA functions like a piano, with each cell playing a different tune. In neurons, the CPEB4 protein acts as a conductor, regulating hundreds of genes essential for brain development. In 2018, Spanish researchers found that people with autism were missing a segment of this protein, linked to the 24 DNA letters. Their new study, published on Wednesday in Nature, reveals how the absence of this segment leads to the deregulation of 200 genes associated with autism spectrum disorders.

Biochemist Raúl Méndez, from the biomedical research institute IRB Barcelona, is an expert on CPEB4. “It is a protein that is synthesized and regulated in response to various types of stress,” explained the scientist during a press conference organized by Science Media Center Spain. “Our working hypothesis, which we have not yet proven 100%, is that during embryonic development some type of stress occurs that triggers this process of loss” of this crucial segment, explained Méndez. The Madrid-born biochemist points to possible causes, such as a chronic diet high in fat or a viral infection.

Fringe anti-vaccination movements have been linking autism to vaccines since 1998, when the discredited British doctor Andrew Wakefield published a fraudulent study that blamed the MMR vaccine for autism spectrum disorders. His conclusions, based on falsified data, have been debunked countless times. For instance, a study involving more than 500,000 children in Denmark found that autism rates were the same among vaccinated and unvaccinated children. “We do not want any anti-vaxxer to use our working hypothesis to question the effectiveness of vaccines,” Méndez emphasizes in a video conference with EL PAÍS.

Formation of solid aggregates of CPEB4 in experiments with purified proteins.
Formation of solid aggregates of CPEB4 in experiments with purified proteins.
IRB Barcelona
Cells use a code to read the 3 trillion letters of human DNA. Every set of three letters is the recipe for an amino acid, the building blocks of proteins, which are the tiny machines that perform most of the tasks in the human body. Méndez and Salvatella’s goal is to test, first in mice genetically modified to simulate autism, whether administering the eight amino acids encoded in the sequence GCAAGGACATATGGGCGAAGGAGA can reverse the disorder.

“We didn’t have a molecular description of what the eight amino acids missing in autism do,” says Salvatella, a 52-year-old researcher from Barcelona who also works at IRB Barcelona. The biophysicist explains that CPEB4 proteins tend to aggregate by the hundreds and form “liquid droplets” inside neurons. When there is neuronal stimulation, the droplets break up and release their contents. However, when those eight amino acids are missing in a large number of CPEB4 proteins, “those droplets basically become solids” that don’t function properly, triggering the deregulation of the 200 genes associated with autism.

The new research is part of the doctoral theses of Carla García Cabau and biophysicist Anna Bartomeu. “Now we need to find a way to reverse these effects, making the droplets liquid again,” as they are when the CPEB4 protein is complete, says Cabau, a 30-year-old researcher from Barcelona. The authors have observed that simply adding the eight missing amino acids is enough to restore the function of the droplets in experiments with purified proteins in the laboratory — a very preliminary but hopeful result.

The researchers are confident that the sequence GCAAGGACATATGGGCGAAGGAGA holds the key. “In the 2018 study, we saw that when these eight amino acids are missing, autism develops and the neuron doesn’t function properly, but we didn’t know why. Now, we understand the role of these eight amino acids in this protein,” explains Méndez. The biochemist is optimistic, even about the possibility of reversing autism’s effects in adults in the future. “In principle, there would be enough neuronal plasticity. In fact, when someone suffers a stroke, the rest of the brain often adapts to recover functions lost in the brain area that has died. More plasticity than that is impossible,” he argues.

The biologist Ana Kostic praises the new research, in which she was not involved. “The study is highly relevant as it elucidates molecular underpinnings of autism spectrum disorder and identifies potential therapeutic approaches,” says Kostic, Director of Drug Discovery and Development at the Seaver Autism Center for Research and Treatment in New York. “One can imagine that manipulating a 24-nucleotide fragment may lead to an improvement in the symptoms associated with idiopathic autism spectrum disorder; however, this hypothesis will need to be validated in preclinical models (as suggested by the authors) and then tested in clinical trials. It is difficult to predict the degree of benefit in different age groups, but it is possible that this approach would lead to an improvement even in adult individuals with autism spectrum disorder,” Kostic notes.

Sign up for our weekly newsletter to get more English-language news coverage from EL PAÍS USA Edition

Others who think for themselves would welcome any treatment to improve their impairments.

My view like the COVID vaccines if you don't want curing or treating don't take it, its not like anyone is going to chase you down the street with a syringe, just live your life and don't concern yourself with the choices of others.

1. All nature publications are peer reviewed as far as i believe, it was a multi team/ multi national study anyway where risk of fraud is minimal

Except you are not thinking for yourself, you're talking about killing a person to create another one, because you feel the other person is worthless. It's the same problem with StarTreks teleporter, it kills you to create a copy, except you are not copying when curing, we are talking replacing one person with another.



And again you keep advocating for killing people, the point of vaccine's is also to protect those who can't handle being vaccinated. Vaccine's is not about the individual only.


Back to the article



Peer review would be that many groups of scientist replicate the test to see if they get the same result. This is a fundamental part of science a single study is WORTHLESS in science. We didn't all overnight convert to Einstein's nonsense (It was considered nonsense to begin with), until countless number of other scientist has figured out what he said was true and some of it took until this day to be verified 100 years for us to learn Einstein was right...

. More specifically, our understanding of how reduced inclusion of me4 in CPEB4 generates a dominant-negative effect, and our observation that the normal activity of me4 can be restored in trans, opens up an opportunity to treat ASD on the basis of regulation of the dynamics of biomolecular assemblies by drug-like small molecules and peptides44.

Interesting discovery, if likely true it means they have found the cause of 80% of autism, which i suspect includes most of us here including myself, even more interesting that in theory autism could be reversed with a simple therapy to correct this developed in the future.

I am skeptical, because the theory implies we should dislike Lady Gaga, and I have no opinion on her music.

I don't think that autism could be reversed easily even so, because birth is a special time when development occurs, and once that development has taken place, only modest changes occur thereafter.

Exactly.

In particular, the brain is built before birth. For the genes to change the way the brain is built, the treatment would have to occur before the brain began. The earliest development of the brain should have started by the time that the pregnancy is usually confirmed. By the time the formation of the first layer of neurons begins, if you want to make genetic changes to affect the neuronal development, they had better of been made before that.